The genes used in this study were previously published 26 30 31 .

All embryos were grown to either early gastrula stages, by raising animals for 24 hours post-fertilization (hpf) at 17°C, or to late gastrula stages, by raising animals for 24 hpf at 25°C. All fixation, in situ probe synthesis, and in situ hybridizations were carried out as previously described 30 32 33 . Images were obtained on a Zeiss Imager M2 in conjunction with the Axiocam HRc and ZenPro software (Carl Zeiss LLC, Thornwood, NY, USA). For gastrula stage analysis, 10 μM DAPT treatment was begun 3 hpf as previously described 26 . For larval stage analysis of DAPT-treated animals, animals were allowed to grow to desired stage (either 24 or 48 hpf at 25°C) and then, animals were incubated in 10 μM DAPT for 24 hours.

The Nvnicd fusion construct was generated by PCR amplifying the intracellular domain of Nvnotch using (Forward 5′ CACCATGGTTGTTGTGCTCGCAGGCGGTAAG 3′ and Reverse 5′ GTCTGATAATAACTCCACTATGTC 3′) PCR primers. The PCR product was then cloned Nvnicd in frame and 5′ to the venus coding sequence using the Gateway cloning vector system (Invitrogen, Carlsbad, CA, USA). Full length Nvdelta was amplified using the (Forward 5′CACCATGCAGCTACTACCACTCCAGCCATCAC 3′ and Reverse 5′ ATATTTCCACTTCCACTTCTTGCCAG 3′) primers and cloned in frame 5′ to the venus coding sequence. Nvhes2 and Nvhes3 constructs were cloned using (Forward 5′ CACCATGGAAAAAATGCGGAGGGCGAG 3′ and Reverse 5′ TCAAATTGTCCTCCCCATTCAC 3′) and (Forward 5′ CACCGCCGTTGACTGCATCGATAGC 3′ and Reverse 5′ TCACCATGGGCGCCACAGTG) PCR primers, respectively. They were both cloned in frame to the 3′ end of the venus coding sequence. Injection concentration of the Nvnicd:venus was 300 ng/μl. Injection concentration of Nvdelta:venus was 900 ng/μl. Injection concentrations of venus:hes2 and venus:hes3 were 300 ng/μl and 150 ng/μl, respectively. We injected the previously published NvashA:venus and NvsuHDN:venus mRNA as described previously (Layden and colleagues 30 and Marlow and colleagues 26 ). mRNA was prepared and injected as previous described 30 34 . Animals were sorted prior to analysis to identify embryos expressing the Venus reporter protein and to eliminate the non-expressing animals.

Fluorescein labeled NvashA translation-blocking MO was injected as published 30 . NvSuH splice-blocking MO was injected, and splice blocking was observed as previously described 26 . An Nvnotch splice-blocking MO (5′ GTCCTTTGATTTCGTACCTCATGGA 3′) (GeneTools Inc., Philomath, OR, USA) that results in a truncation of the Nvnotch intracellular domain and Nvdelta splice-blocking MO (5′ GCGACCTGACAAGAACAGTGAAGTC 3′) (GeneTools Inc.) that removes the exon containing the MNNL domain were designed and injected at 1 mM and 600 nM, respectively. Splice-blocking efficiency was estimated using PCR and DNA electrophoresis to observe shifts in the size of the wild-type or morphant mRNA. A control MO (5′ AGAGGAAGAATAACATACCCTGTCC 3′) was also injected at a concentration of 1 mM and gene expression was compared to uninjected control animals. Animals were sorted after injection to eliminate the uninjected animals as indicated by the lack of fluorescence.

To count the number of NvashA-expressing cells we mounted animals with the aboral end up, visualized using the 10× objective on the Zeiss Imager M2 (Carl Zeiss LLC). We normalized the focal plane by focusing on the most superficial level of the aboral ectoderm and then counted the total number of visible cells.

RNA isolation and quantitative (q)PCR analyses were conducted as previously described 30 . Nvactin, Nvef1B, and Nvatpsynthase house-keeping genes were used to normalize fold change in qPCR experiments. All qPCR primers used have been previously described 26 30 35 . Each qPCR analysis was repeated in triplicate pools of embryos injected in independent sessions. Based on previous studies, we consider a fold change greater than 1.5 meaningful. We often fail to detect changes in expression via alternative approaches for fold-changes less than 1.5.

Previous studies showed that Nvnotch and Nvdelta are expressed in tissues known to be undergoing differentiation in late gastrula through juvenile polyp developmental stages 26 . However, multiple studies suggest differentiation in Nematostella is first observed in the early gastrula when expression of neural genes NvashA 30 and Nvelav 31 36 are detected. We tested for both Nvnotch and Nvdelta expression by mRNA in situ hybridization in early gastrula animals (Figure  1). Initially, Nvnotch and Nvdelta expression is distributed in a “salt and pepper” pattern (Figure  1A,C), meaning that the cells that are expressing Nvdelta and Nvnotch are distributed throughout the ectoderm and appear like pepper granules mixed into a pile of salt. The Nvnotch “salt and pepper” pattern is slightly variable in that it appears patchy as if there are clusters of Nvnotch expressing cells distributed in the “salt and pepper” pattern (Figure  1C, yellow arrow). The expression of both genes expands over time, and both genes are ubiquitously expressed by the late gastrula stage (Figure  1B,D). Interestingly, within the ubiquitous Nvdelta expression, there is a “salt and pepper” distribution of cells that appear enriched for Nvdelta (Figure  2B, white arrows). Based on the spatiotemporal expression patterns previously reported 26 and extended here, Nvnotch and Nvdelta expression is consistent with the earliest onset of cellular differentiation.

To determine if Notch signaling in Nematostella functions to regulate cellular differentiation, we chose to characterize the effects of NvNotch activity on the expression of the previously identified neural differentiation gene NvashA. Previous reports showed that continuous treatment with DAPT for 72 hours resulted in an upregulation of NvashA 26 , but this study did not characterize earlier DAPT phenotypes. We assayed gastrula treated with 10 μM DAPT for NvashA expression by mRNA in situ hybridization and qPCR (Additional file 1; Figure  2). NvashA expression levels increased by approximately two-fold in DAPT treated animals (Additional file 1; Figure  2G). Because DAPT does not directly inhibit Notch signaling, we were concerned that the DAPT NvashA phenotype may be caused by a disruption of a pathway other than Notch. To confirm that Notch signaling specifically inhibits NvashA expression, we generated splice-blocking MOs directed against the Nvdelta ligand and the Nvnotch receptor (Additional file 2A). The splice-blocking Nvnotch MO results in Nvnotch mRNAs containing stop codons that result in a premature truncation of the Notch intracellular domain (data not shown). Injection of the Nvnotch splice-blocking MO resulted in a cell that appeared to express relatively higher levels of NvashA compared to control (compare Figure  2A and D to B and E), a two-fold increase in NvashA expression measured by qPCR (Figure  2G), and a 60% increase in the number of NvashA positive cells (Figure  2H). The similar increase in NvashA expression observed in DAPT-treated and Nvnotch MO-injected animals suggest that the NvashA phenotype observed in DAPT-treated animals is specifically due to inhibition of NvNotch. A splice-blocking MO generated against NvDelta generates a miss-spliced transcript that encodes an Nvdelta transcript only missing the MNNL domain present in the extracellular region of the protein (Additional file 2A; data not shown). Injection of the Nvdelta splice-blocking MO results in an approximate 1.6-fold increase in NvashA expression (Figure  2G). This demonstrates that NvNotch and NvDelta are both required to repress NvashA in the embryonic ectoderm.

To further confirm that Notch activity functions to repress NvashA, we used two approaches to overactivate Notch activity. First, we mimicked constitutively active Notch by injecting an mRNA encoding the Nvnotch intracellular domain fused in frame to the venus coding sequence (Nvnicd:venus) 37 . We observed NvNicd:Venus nuclear localization (Additional file 2D), and a nearly complete repression of NvashA expression as detected by mRNA in situ hybridization (Compare Figure  2A and D to C and F), and an approximate six-fold reduction in NvashA levels as detected by qPCR (Figure  2G). Second, we overactivated Notch activity by injecting mRNA encoding for the full length Nvdelta gene fused to the venus reporter (Nvdelta:venus). Overexpression of Nvdelta showed lower levels of NvashA expression by mRNA in situ hybridization (Figure  3). We observed weak NvashA expression in 57% of the Nvdelta:venus injected animals (Figure  3A,B) and an approximate three-fold reduction in NvashA expression as measured by qPCR (Figure  3C, light grey bar). To determine if the suppression of NvashA by Nvdelta required NvNotch, we treated Nvdelta:venus injected animals with DAPT. Treating Nvdelta:venus injected animals with DAPT resulted in a two-fold upregulation of NvashA (Figure  3C, dark grey bar). This is consistent with the previously observed phenotypes following DAPT treatment and NvNotch MO injection (Figure  2), and suggests that NvNotch acts to inhibit NvashA expression when activated by interactions with NvDelta.

To determine if changes in NvashA levels downstream of Notch activity correspond to changes in NvashA-dependent neurogenesis, we assayed for changes in expression of the previously identified NvashA neural target genes 30 . Overactivation of Notch activity by either injection of the full length Nvdelta:venus or injection of the Nvnicd:venus construct resulted in a dramatic downregulation of NvashA neural target genes (Figure  4A,D,G, dark blue bars; Additional file 3, light grey bars). Co-injection of NvashA:venus mRNA with the Nvnicd:venus mRNA was sufficient to suppress the reduction of neural gene expression phenotype resulting from overactivation of Notch activity (Figure  4C,F,G, light blue bars). Many of the NvashA:venus Nvnicd:venus co-injected embryos assayed by in situ hybridization showed neural gene expression phenotypes consistent with the increased number of neurons observed when NvashA is expressed alone (Figure  4C,F) 30 . Treatment with DAPT increased the levels of neural gene expression (Figure  4A, dark orange bars). Co-injection of the NvashA translation-blocking MO 30 suppresses the DAPT induced upregulation of neural gene expression (Figure  4A, light orange bars). These data suggest that Notch activity suppresses NvashA-dependent neurogenesis primarily through the specific inhibition of NvashA expression rather than broadly targeting downstream genes expressed in differentiating neurons.

We wanted to test whether Notch activity regulates NvashA at later developmental stages independently of the earlier roles described above. In order to disrupt Notch signaling at later stages without disrupting Notch signaling at early stages we opted to use DAPT treatments. Although DAPT treatment may not specifically disrupt Notch signaling, the increase in NvashA following treatment with DAPT or injection of the Nvnotch MO in the embryo are identical (Figure  1), which suggests the DAPT NvashA phenotype is due to a disruption of Notch signaling. We performed two DAPT treatments (Figure  5). The first treatment began at the late gastrula stage and continued for 24 hours into the early planula larval stages (Figure  5A-C). We detected NvashA expression in the forming pharynx (Figure  5A, arrow), in a “salt and pepper” pattern in the ectoderm (Figure  5A, inset), and some weak staining in a “salt and pepper” pattern within the endoderm in control planulae (Figure  5A, arrow head). Treatment with DAPT resulted in an increase in pharyngeal staining (Figure  5B, arrow) and an increase in the number of ectodermal cells expressing NvashA (Figure  5B, inset). It was difficult to be certain that endodermal NvashA was increased because of the strong ectodermal expression, but it appears as if there is an expansion of NvashA expression in the endoderm as well. We were also able to classify animals into groups of animals having no, weak, normal wild-type, or strong NvashA expression for both control and DAPT-treated animals. In control animals, approximately 70% of the animals had wild-type levels of NvashA expression, and only approximately 10% of the animals had strong expression of NvashA. In DAPT-treated animals 90% of the animals displayed the strong expression phenotype. We also observed a three-fold increase in NvashA expression in DAPT-treated animals by qPCR (Figure  5C). We also treated animals with DAPT from 48 to 72 hpf, which ensured animals were all within the larval stages of development during the treatment (Figure  5D-F). NvashA expression in control 72 hpf planulae was detected in the pharynx and forming mesentery structures (Figure  5D, arrow) and in a “salt and pepper” endodermal pattern. We did not detect any ectodermal NvashA expression in 72 hpf animals. Animals treated with DAPT from 48 to 72 hpf showed a strong increase in NvashA in the forming pharynx and mesenteries (Figure  5E, arrow), and the endoderm has an increase in NvashA expression levels. As before, we could easily group phenotypic classes for NvashA expression: in control animals, 80% of the animals showed wild-type expression levels and only approximately 7% showed the strong NvashA expression phenotype (Figure  5D). However, in the DAPT-treated animals 86% of the animals displayed the strong NvashA expression phenotype (Figure  5E). DAPT-treated animals also had an approximate three-fold increase in NvashA expression levels by qPCR (Figure  5F). These data demonstrate that DAPT treatment promotes an increase in NvashA at later stages, and that similar mechanisms regulate both embryonic and larval differentiation. Moreover, these results argue that the dynamic expression patterns observed for Nvnotch and Nvdelta (ectoderm in early embryo and moving into the endoderm in larval stages 26 ) supports the hypothesis that Nvnotch regulates cellular differentiation in multiple tissues throughout development in Nematostella.

Lastly, we wondered if Notch activity might influence expression levels of other differentiation genes unrelated to NvashA. We used previously described differentiation genes, Nvgcm, Nvsoxb2, Nvsox2, Nvmef2.iv, and Nvminicol4 31 38 39 40 , as well as two recently identified genes, Nvcoup1 and Nvath-like1 (Figure  6), that, like NvashA, are all expressed in a “salt and pepper” pattern. It should be noted that all of these genes are associated with neuronal differentiation, though only Nvmef2.iv and Nvminicol4 have been definitively linked to neural development. They regulate formation of the cnidocyte neural cell type 39 40 . As we observed for NvashA, inhibiting Notch activity by treating with DAPT (Figure  6, blue bars) or injecting the Nvnotch MO (Additional file 4, green bars) increased expression levels for nearly all the “salt and pepper” genes assayed. The only genes assayed that showed no significant increase in expression levels following treatment with DAPT were Nvmef2.iv and Nvminicol4, though Nvminicol4 was upregulated following Nvnotch MO injection (Additional file 4). We also included Nvsox1, Nvsox3, Nvsoxe1, and Nvets1a because they are expressed in distinct broad domains rather than in a “salt and pepper” pattern, which suggests that they are involved in patterning regional domains rather than differentiation. Expression levels of the “broadly expressed” genes did not change following DAPT treatment or injection of the Nvnotch MO. Overactivation of Notch signaling by injecting Nvnicd:venus suppressed expression of all of the “salt and pepper” genes (Figure  6, dark orange bars), including Nvmef2.iv and Nvminicol4. Again, the broadly expressed genes were unaffected by Nvnicd injection.

To confirm these genes are independent of NvashA, we attempted to rescue the loss of “salt and pepper” gene expression resulting from overactivation of Notch signaling by co-injecting the Nvnicd:venus and the NvashA:venus constructs (Figure  6, light orange bars). Only Nvgcm was rescued by expression of NvashA. This suggests that, with the exception of Nvgcm, the “salt and pepper” genes are not targets of NvashA. Therefore, we suggest Notch activity broadly regulates expression of genes associated with neural differentiation in the Nematostella embryo.

Suppression of NvashA by activated Notch signaling can occur through the canonical (suH and hes gene-dependent), the non-canonical (suH and hes gene-independent), or through both pathways. We tested the putative contributions of the canonical and non-canonical pathways in Nematostella. First, we tested if Nvnotch regulated the expression of Nvhes genes. Four Nvhes genes, Nvhes1, 2, 3, Nvhl1, are expressed in Nematostella embryos and could potentially be regulating NvashA 26 . However, only Nvhes2 and Nvhes3 expression is detected by mRNA in situ hybridization in the early gastrula when the earliest onset of differentiation of NvashA positive cells is occurring 26 . We compared changes in expression for each of these genes using qPCR following treatment with DAPT (Figure  7, blue bars), injection of the Nvnotch MO (Figure  7, orange bars), and following injection of the Nvnicd:venus mRNA (Figure  7, purple bars). Treatment with DAPT resulted in an approximate two-fold reduction in Nvhes1 and Nvhl1 levels. The Nvhes2 and Nvhes3 genes both showed a greater than eight-fold reduction in expression following DAPT treatment (Figure  7A, blue bars). However, Nvnotch MO injected animals showed no change in Nvhes1 or Nvhl1 expression, and a relatively minor decrease in Nvhes2 and Nvhes3 levels (Figure  7A, orange bars). We failed to detect any reduction of Nvhes2 or Nvhes3 in Nvnotch morphants by mRNA in situ hybridization (Figure  7B-E). Because the NvashA phenotype resulting from injection of the Nvnotch MO is as severe as treatment with DAPT (Figure  1), and there is little wild-type Nvnotch transcript in the Nvnotch morphant animals (Additional file 2A), we believe the Notch MO to be highly efficient. However, we were concerned that low levels of Nvnotch activity may be sufficient to promote Nvhes gene expression in the embryo. To address this we overactivated Notch signaling by injecting the Nvnicd:venus and Nvdelta:venus constructs, which should increase Nvhes expression if the canonical pathway was intact. We observed no significant change for Nvhes1-3 and only a minor increase in Nvhl1 expression following injection of Nvnicd:venus (Figure  7E, purple bars). Similarly, injection of the Nvdelta:venus mRNA failed to induce expression of any of the Nvhes genes. Thus, our data suggest that, although DAPT treatment reduces the expression levels of Nvhes1-3 or Nvhl1 in Nematostella embryos, the observed downregulation is Nvnotch-independent.

Even though Nvnotch does not regulate Nvhes genes we still wanted to test if NvsuH regulated Nvhes genes, and if Nvhes genes were sufficient to suppress NvashA expression. Nvhes2 and Nvhes3 are the only two Nvhes genes that have expression that initiates in the early embryo when the first cellular differentiation is observed in Nematostella. We overexpressed Nvhes2 and Nvhes3 by injecting venus:Nvhes2 and venus:Nvhes3 mRNAs. Nvhes2 or Nvhes3 overexpression did not result in any changes in the levels of NvashA as detected by mRNA in situ hybridization (Figure  8A-F) or qPCR (Figure  8G). We tested if NvsuH regulated Nvhes genes or NvashA by injecting both an NvsuH MO and a dominant negative NvsuH 26 . Neither of these manipulations resulted in detectable changes of Nvhes or NvashA expression by qPCR (Figure  8H). These data suggest that the canonical Notch pathway does not regulate NvashA-dependent neural development in the early Nematostella embryo.

To determine if canonical Notch signaling could regulate the NvashA-independent “salt and pepper” expressed genes associated with cellular differentiation, we tested whether overexpressing Nvhes2 or Nvhes3 via injection of the venus:Nvhes2 or venus:Nvhes3 mRNA could suppress expression of the “salt and pepper” genes. We saw no change in the expression levels by qPCR for any of the “salt and pepper” genes assayed here (Additional file 4, light and dark blue bars). Thus, it appears that non-canonical Notch signaling broadly suppresses expression of genes that promote neural differentiation in Nematostella embryos.

Our data show that NvNotch is activated by NvDelta to regulate cellular differentiation in Nematostella, but based on our observations here it is likely that Notch activity in Nematostella regulates the competence of cells to respond to a variety of instructive differentiation cues. Elevated levels of Notch activity suppress differentiated cell markers, while decreased levels of Notch activity increase expression of differentiated cell markers (Figures  1 and 8; Additional file 1). However, inhibition of Notch signaling is not sufficient to induce a total transformation of cells into differentiated cells. This suggests that Notch either acts at defined time points in the differentiation process or that Notch-independent instructive cues act to induce particular differentiated cell types. Our model predicts that the relative level of Notch activity and the amount of inductive signal coordinate to determine if differentiation will occur. Consistent with this prediction, extending treatment with DAPT to 3 days results in animals that have a more pronounced expansion of differentiated cell markers than our early shorter treatment 26 . One interpretation is that extended inhibition of Notch activity provides more opportunity for undifferentiated cells to encounter and respond to external inductive cues. Additionally, quantification of the number of cells expressing any one “salt and pepper” gene is not often reproducible from animal to animal (Figure  1H; unpublished observations) 30 , suggesting that the mechanism governing the number of cells of a distinct cell type is somewhat stochastic. Taken together these observations argue that, in any given animal at a given time, there are variable numbers of cells competent to respond to distinct differentiation cues. Our data supports the hypothesis that the competence is in part regulated by Nvnotch activity.

Notch appears to function broadly to inhibit neural differentiation. We tested a number of genes that have been previously reported to be associated with differentiation during Nematostella development (Figure  6; Additional file 3). We found that inhibiting Nvnotch by injecting the Nvnotch MO or by treating with DAPT resulted in upregulation of the differentiated markers. Conversely, overactivation of Notch by overexpressing the Nvnicd:venus mRNA suppressed expression of the differentiation markers. The markers that we used (NvashA, Nvsox2, Nvgcm, Nvsoxb2, Nvath-like, Nvmef2.iv, Nvminicol4, Nvcoup1-like) are all predicted to be associated with neurogenesis and/or cnidocyte development in Nematostella, although (with the exception of NvashA, Nvmef2.iv, and Nvminicol4) none of them are confirmed regulators of neural development. Thus, we cannot conclude at this point if Notch broadly regulates expression of all differentiated cell types or specifically regulates neural development in Nematostella. Even if the differentiation genes we chose are specific to neural development we argue that they are independent of NvashA-dependent neural development. We show that, other than Nvgcm, none of the differentiation genes assayed here can be rescued when NvashA is overexpressed in animals with increased Notch activity (Figure  5). Also, we have not observed any co-expression of Nvsoxb2 or Nvsox2 with NvashA neural targets, and both NvsoxB2 and Nvsox2 are expressed in what appears to be many more cells than NvashA 38 (unpublished observation). Thus, we are confident that Notch activity broadly inhibits expression of genes associated with neural differentiation, but cannot determine what other cell types might be regulated by Notch activity.

We also propose that Notch regulation of differentiation is a reiterative process during Nematostella development. Differentiation begins during the early gastrula stage of Nematostella development, but continues throughout embryonic and larval stages. The expression patterns of NvashA and other known developmental genes are known to be dynamic throughout these stages 30 31 36 38 . Expression of Notch signaling components appears to be enriched in tissues likely to be undergoing cellular differentiation during development. For example, the embryonic expression of Nvnotch and Nvdelta initiate in the ectoderm, and are maintained there until late planula stages (Figure  2) 26 . In early planula stages the endoderm begins to show expression of differentiated cell markers 31 36 . Endodermal expression of Nvnotch and Nvdelta are coincident with endodermal differentiation. Nvnotch and Nvdelta are expressed in the forming and growing tentacle buds 26 (unpublished observation), and expression in juvenile and adult polyps is maintained in the endodermal portion of the eight mesenteries 26 , where constant differentiation of nematosomes is known to occur 41 . We also found that treating with DAPT for distinct time windows throughout larval development resulted in the increased NvashA expression (Figure  5). This suggests that the same or a similar mechanism controls NvashA expression at later time points and in different tissues (endoderm versus ectoderm) than during embryonic development. We would like to extend this temporal analysis to gene-specific knockdowns of Nvnotch. However, we focused this initial study on the early embryonic roles of Nvnotch because conditional knockdown of Nvnotch function specifically at later time points is still difficult in Nematostella. As the technology of conditional alleles to disrupt gene function specifically at distinct life stages in Nematostella advances, and as identification of genes that serve as markers for cells differentiated within distinct temporal windows are found, our model can be tested further. We predict that disrupting Notch activity in distinct temporal windows should disrupt only the cell types that are normally born within that time frame.

The emergence of multicellular animals with specialized cell types had to require a mechanism to regulate whether cells differentiate or remain pluripotent. Notch has been shown to have a highly conserved role as a regulator of differentiation in nearly all bilaterian tissues. However, prior to this study it was unclear how Notch functioned in non-bilaterian animals, and thus there was little inference about ancestral Notch function. We show that non-canonical Notch signaling in the cnidarian sea anemone, Nematostella vectensis, broadly inhibits cellular differentiation during development. This provides a clear example of Notch regulating differentiation outside of Bilateria. Given how highly conserved the role for Notch as a regulator of differentiation appears, and the fact that core Notch components evolved specifically in metazoans, it is likely that Notch regulates differentiation in all metazoans. To fully support this hypothesis we need to reconstruct the function of Notch signaling in the common ancestor of all metazoans by characterizing the role of Notch in animals representing the earliest diverged metazoan lineage. The sister lineage to the rest of animals is still being debated, but the current consensus is that it is either Ctenophora or Porifera. Disruption of gene function in either of these groups has proven difficult, but we can infer putative function based on expression patterns. Expression of notch and delta homologs in the poriferan A. queenslandica initiates expression in a spatiotemporal pattern consistent with regulators of cellular differentation 25 . The amqdelta homologs appear to be expressed in differentiating and differentiated cell types consistent with the idea that they activate Notch to suppress differentiation in the surrounding cells, while having low Notch activity themselves 25 . The expression patterns of Notch signaling homologs in ctenophores are not known, and definitive homologs for delta have not been found. Thus, we cannot predict putative functions for Notch signaling in that lineage.

Our results suggest that canonical Notch signaling is not present in the cnidarian lineage and that the canonical pathway evolved in the stem of the bilaterian lineage. In Nematostella, gene-specific knockdown of Nvnotch, NvsuH, or overactivation of Nvnicd did not significantly affect expression levels of Nvhes genes, which are an important target of the canonical Notch signaling pathway. Overactivation of Notch signaling by overexpressing either Nvnicd or Nvdelta was sufficient to suppress expression of differentiated cell markers, but both failed to upregulate any of the Nvhes genes monitored (Figure  5). Furthermore, overexpression of Nvhes2 or Nvhes3 failed to suppress NvashA or other genes associated with cellular differentiation (Figure  5; Additional file 4). In addition, the expression of Nvhes homologs throughout Nematostella development are inconsistent with the notion that they are targets of Nvnotch signaling. Most Nvhes genes show minimal overlap with Nvnotch expression outside of the embryonic ectoderm 26 . Three exceptions to this are Nvhes3 and Nvhl1, which overlap with Nvnotch expression in the oral ectoderm and aboral ectoderm during planula stages 26 , and Nvhes1, which overlaps with the Nvnotch expression in the planula endoderm. However, Nvhes1 expression appears ubiquitous in the planula stages, whereas Nvnotch expression becomes limited to the endoderm, suggesting that the Nvhes1 expression is regulated by factors other than Nvnotch. The reported expression of NvsuH is also inconsistent with the idea that canonical Notch signaling regulates differentiation. NvsuH is not expressed in the differentiating ectoderm at the onset of cellular differentiation in the early gastrula when expression of NvashA and the “salt and pepper” genes is initiated 26 . However, NvsuH is expressed ubiquitously later in the planula larval stages.

A closer examination of the phylogenetic distribution of canonical Notch signaling components in the three published cnidarian genomes also supports the lack of an intact canonical Notch pathway in cnidarians 4 23 24 . Previous analysis suggested that the cnidarian-bilaterian common ancestor was the first animal with a compliment of genes that participate in canonical Notch signaling 19 . However, the cnidarian homologs of the transcriptional co-activator mastermind that is recruited to activate hes expression are only weakly conserved at best with bilaterian homologs 1 19 . Moreover, SuH also interacts with the SMRT co-repressor to suppress expression of hes homologs when Notch signaling is not active. smrt homologs have not been identified in any of the currently published cnidarian genomes 4 19 23 24 .

It should be noted that most of the Nvhes genes are severely downregulated following DAPT treatment (Figure  5) 26 . However, our data argue that the DAPT-induced Nvhes phenotypes occur independently of Nvnotch. The current draft of the Nematostella genome describes only a single Nvnotch gene. However, there are additional single pass transmembrane proteins that, like Nvnotch, have EFG repeats in their extracellular domain (unpublished observation) 24 . The intracellular domains of these proteins lack the typical intracellular domains linking Notch signaling to hes gene regulation 19 26 , but because the γ-secretase complex is believed to cleave most single pass transmembrane signaling proteins, it is reasonable to hypothesize that DAPT is affecting one or more of these “Notch-like” proteins, and that they may regulate hes expression. Given that activation of hes expression is a hallmark of canonical Notch signaling, we speculate that some aspect of hes biology underlies the emergence of the canonical pathway. One explanation could be based on the fact that hes genes function as oscillators that promote cell proliferation 13 42 . Interestingly, we observe Nvhes2 expression in proliferating cells (unpublished observation). Because high Notch activity often suppresses differentiation, perhaps incorporating regulation of proliferation downstream of Notch activity provided a mechanism to both suppress differentiation and promote proliferation. This is consistent with the observation that canonical Notch activity in the development of many bilaterian tissues is often associated with maintaining tissue-specific stem cells 8 .

To verify that canonical Notch signaling is not intact in the cnidarian-bilaterian ancestor gene specific functional studies need to be conducted in other cnidarian species. Additional analyses need to be done in Nematostella once tools emerge to investigate roles for Notch signaling specifically during post-embryonic development. Currently, attempting to interpret late-stage phenotypes in morphant animals is complicated because it is unclear how early disruption of Nvnotch influences later development. Temporal-specific treatments with DAPT would not be informative because we showed that the responses of Nvhes genes to DAPT in the embryo are Nvnotch-independent phenotypes.